![]() |
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CELLULAR AND MOLECULAR
Departments of Ophthalmology (C.E.C., P.W.Y., A.N.B., S.H.), MUSC-Hewitt Laboratory of the Ola B. Williams Glaucoma Center, and Medicine (Y.V.M.), Medical University of South Carolina, Charleston, South Carolina
Received September 19, 2003; accepted January 16, 2004.
| Abstract |
|---|
|
|
|---|
The presence of adenine nucleotides in the humor of the eye has been known for some time (Greiner et al., 1991
). Recent studies have also provided evidence that the activation of ocular P2 receptors can modulate intraocular pressure (IOP) (Pintor et al., 2003
). However, little is known about the expression and associated signaling events of P2 purinergic receptor subtypes in anterior segment tissues of the eye. The trabecular meshwork is a specialized region in the anterior chamber of the eye composed of connective tissue beams lined with smooth-muscle-like trabecular meshwork cells (Wiederholt et al., 2000
). This meshwork forms the primary pathway for drainage of aqueous humor from the anterior chamber. Cells of the trabecular meshwork are thought to influence IOP through their phagocytic actions (Tripathi and Tripathi, 1984
), morphological changes altering intertrabecular space (Wiederholt et al., 2000
), and influencing the extracellular matrix turnover (Yue, 1996
; Shearer and Crosson, 2001
). Consequently, pharmacological agents that target trabecular meshwork cells have the potential to regulate outflow resistance and IOP.
In these studies, we sought to determine whether trabecular meshwork cells express receptors for adenine and uracil nucleotides, and begin to assess the signal transduction pathways coupled to these receptors. Our results show that trabecular meshwork cells express P2Y1, P2Y4, and P2Y11 purinergic receptor subtypes. The activation of these receptors by P2 agonists leads to mobilization of intracellular Ca2+ and activation of the extracellular signal-regulated kinase (ERK)1/2 pathway.
| Materials and Methods |
|---|
|
|
|---|
Cell Culture. Primary bovine trabecular cell cultures were established from trabecular meshwork explants by techniques described previously (Shearer and Crosson, 2001
). Briefly, small strips of trabecular meshwork tissue were dissected from one or two eyes and homogenized by means of a Teflon hand-held homogenizer in DMEM containing 15% fetal bovine serum (FBS). The homogenized tissue was plated onto a 60-mm collagen-I-coated (Biocoat, Fort Washington, PA) cell culture plate and allowed to grow for 2 weeks in DMEM containing 15% FBS. The resultant cells were harvested and plated onto polypropylene cell culture plates in DMEM containing 10% FBS. Second- or third-passaged cells were used in all studies. The transformed human trabecular meshwork cell line HTM-3 was maintained on polypropylene cell culture plates and grown in DMEM containing 10% FBS (Pang et al., 1994
). These cells were allowed to grow to approximately 80% confluence.
Determination of Intracellular Calcium. Intracellular free Ca2+ was determined using a fluorometric imaging plate reader system (Molecular Devices Corp., Sunnyvale, CA). Cells for intracellular Ca2+ measurements were subcultured into 96-well clear-bottom black microplates (Costar; Cambridge, MA). On the day of each experiment, cells were incubated with 4 µM fluo 3-AM (excitation at 488 nm, emission at 540 nm; Molecular Probes) in HEPES buffer (pH 7.4) containing 2.5 mM probenecid for 1 h at 37°C. Cells were then washed four times, placed in the fluorometric imaging plate reader, and each well of the microplate was monitored at 1.5-s intervals over 6 min. Six wells were averaged for each individual value and experiments were repeated at least three times. In selected experiments, the contribution of extracellular Ca2+ to these responses was investigated by omitting Ca2+ from the incubation buffer and adding 2 mM EDTA. In cross-desensitization studies, agonist treatments were separated by 2 min. For antagonist studies, cells were treated for 10 min with individual antagonists before the addition of P2 agonists.
ERK Assay. Cells were maintained in serum-free medium for 16 h before the addition of any agent. Cells were then treated with P2 agonists for 10 min. In experiments evaluating the P2 antagonist U-0126 or chelerythrine chloride, cells were pretreated for 30 min with individual agents before the addition of the agonist. At the end of the incubation periods, cells were rinsed with ice-cold phosphate-buffered saline and lysed by the addition of 0.5 ml of lysis buffer (50 mM
-glycerophosphate, 20 mM EGTA, 15 mM MgCl2, 1 mM Na3VO4, 1 mM dithiothreitol, and 1 µg/ml of a protease inhibitor cocktail; Roche Diagnostics, Indianapolis, IN). To determine the level of ERK1/2 activation (phosphorylation), equivalent amounts of protein (15 µg) were loaded onto 12% SDS-polyacrylamide gels, and proteins were separated according to molecular weight using standard SDS-polyacrylamide gel electrophoresis protocols and transferred to a nitrocellulose membrane. Total ERK levels (phosphorylated and nonphosphorylated forms) were determined by immunoblot techniques using polyclonal anti-ERK1/2 antibodies (New England Biolabs, Beverly, MA). Bands were visualized by the addition of anti-rabbit horseradish peroxidase-conjugated secondary antibodies and enhanced chemiluminescence reagents (Amersham Biosciences Inc., Piscataway, NJ). Blots were then stripped by incubation in "stripping buffer" (62.5 mM Tris, pH 6.7, 100 mM
-mercaptoethanol, and 2% SDS) for 30 min at 50°C. The level of phosphorylated (activated) ERK1/2 was then determined by immunoblot analysis with polyclonal anti-phospho-ERK antibodies (New England Biolabs) and visualized by the addition of anti-rabbit horseradish peroxidase-conjugated secondary antibodies and enhanced chemiluminescence reagents. Band densities were quantified by means of a Versa Doc imaging system (Bio-Rad, Hercules CA), and the level of phosphorylated ERK1/2 isoforms was normalized for differences in loading, using band intensities from immunoblots of total ERK protein.
Reverse Transcription-Polymerase Chain Reaction. Total RNA was isolated from HTM-3 cells using a TRIzol reagent RNA isolation kit (Invitrogen) according to the manufacturer's instruction. Two micrograms of total RNA were reversely transcribed for cDNA synthesis using SuperScript RNase H-Reverse Transcriptase and oligo(dT)-12-18 primer (Invitrogen). Amplifications of targeted purinergic receptor cDNA were performed with specific primers that were designed based on GenBank nucleotide sequences. The PCR was allowed to proceed in a final volume of 20 µl in a programmable Master Cycler Gradient Thermocycle (Eppendorf, Mansfield, TX) with the following settings: 5 min at 95°C for initial denaturation followed by repeated cycles of denaturation at 95°C for 3 min, primer annealing for 1 min at 55°C, and extension at 72°C for 1 min 30 s. After the final cycle, further extension was allowed to proceed for another 10 min at 72°C. The PCR products were resolved on a 1.0% ethidium bromide-stained agarose gel and then visualized under ultraviolet light transillumination. PCR product sizes were estimated from the migration of a DNA size marker run concurrently (1 kilobase plus DNA Ladder; Invitrogen). For each sample, PCR was performed on RNA that had not been reversely transcribed to confirm that no genomic DNA was present in the samples. Positive reaction products were sequenced to confirm cDNA identity. Primers for each receptor were as follows: P2Y1 (forward primer) TGTGGTGTACCCCCTCAAGTCCC (reverse primer) ATCCGTAACAGCCCAGAATCAGCA; P2Y2 (forward primer) GAGCATCCTGACCTGGAGAG (reverse primer) AGTGCATCAGACACAGCCAG; P2Y4 (forward primer) CCACCTGGCATTGTCAGACACC (reverse primer) GAGTGACCAGGCAGGGCACGC; P2Y6 (forward primer) CGCTTCCTCTTCTATGCCAACC (reverse primer) CCATCCTGGCGGCACAGGCGGC; and P2Y11 (forward primer) ACAGAGCGTATAGCCTGGTG (reverse primer) ACTGCGGCCATGTAGAGTAG.
Statistical Analysis. Data are presented as the mean ± S.E. and were analyzed using analysis of variance followed by Duncan's multiple range test for detecting differences, with P < 0.05 considered as significant. The dose-response curves were analyzed by nonlinear regression analysis (GraphPad Software Inc., San Diego, CA).
| Results |
|---|
|
|
|---|
|
|
|
To further characterize the P2 agonist-induced response in trabecular cells, the effects of P2Y1-receptor antagonist MRS-2179 and the nonselective P2 antagonists suramin and PPADS were evaluated. The increases in intracellular-free Ca2+ induced by 2-MeS-ATP and -ADP were blocked by the presence of MRS-2179 (10 µM) (Fig. 3). However, the ATP- and UTP-induced increase in Ca2+ mobilization was not altered by the presence of MRS-2179. Pretreatment of cells with nonselective P2 antagonists suramin and PPADS (10 µM) each significantly inhibited the ADP- and 2-MeS-ATP-induced rise in intracellular Ca2+ by 60 to 80%, but it did not significantly alter the responses to ATP or UTP. Pretreatment with the adenosine receptor antagonist 8-SPT (10 µM) did not significantly alter the rise in intracellular Ca2+ induced by any of the P2 agonists (data not shown).
|
To evaluate cross-desensitization between ATP and UTP, agonists were administered sequentially within a 2-min interval. The addition of ATP (10 µM) did not alter the subsequent addition of UTP. However, the addition of UTP (10 µM) reduced the response to ATP by 26% (P < 0.05).
Effects of P2 Agonists on ERK1/2 Activation. As shown in Fig. 4, the addition of 10-7 mol/l ATP, UTP, ADP, and 2-MeS-ATP to bovine trabecular meshwork cells produced a significant increase in ERK1/2 phosphorylation. No increase in ERK1/2 activation was observed after the addition of UDP. In HTM-3 cells the addition of ATP, UTP, ADP, and 2-MeS-ATP increased ERK1/2 activation by 233, 228, 247, and 190%, respectively. In both culture systems, the increase in ERK1/2 activation induced by each P2 agonist was not altered by pretreatment with MRS-2179, PPADS, or suramin (data not shown).
|
To investigate the upstream signaling events associated with P2 agonist-induced stimulation of ERK1/2, cells were pretreated with the MEK inhibitor U-0126 or the PKC inhibitor chelerythrine chloride. As shown in Fig. 5, pretreatment of BTM cells with U-0126 (1.0 mol/l) blocked the ERK activation induced by ATP or UTP (10-7 mol/l). Pretreatment with the PKC inhibitor chelerythrine chloride (20 µM), also completely blocked the ATP- and UTP-induced ERK1/2 activation in these cells. In HTM-3 cells, pretreatment with U-0126 or chelerythrine also completely blocked the ERK1/2 activation induced by ATP or UTP (10-7 mol/l).
|
Expression of P2Y Receptor Subtype mRNA in BTM and HTM-3 Cells. To investigate the expression of P2Y-receptor subtypes, mRNA from human cell line (HTM-3) was analyzed by RT-PCR. As shown in Fig. 6, mRNA for P2Y1, P2Y4, and P2Y11 receptors was detected in HTM-3 cells. However, no message for P2Y2 and P2Y6 receptors could be detected in these cells.
|
| Discussion |
|---|
|
|
|---|
The addition of a P2 agonist to human or bovine trabecular cells produced a rapid rise in intracellular Ca2+. This increase in intracellular Ca2+ did not seem to result from the activation of ionotropic P2X receptors, because it was not blocked by the incubation of cells in Ca2+-free media. Although adenosine receptors have been identified on trabecular meshwork cells (Shearer and Crosson, 2002
), the inability of the adenosine antagonist 8-SPT to alter the response to adenine and uracil nucleotides demonstrates that the activation of adenosine receptors did not contribute to responses observed in these studies. Together, these data support the idea that the responses induced by P2 agonists in trabecular cells are mediated by P2Y receptors.
The difference in response maxima (Table 1) and the selective blockade of P2 agonists responses by MRS-2179 (Fig. 3), indicate that the activation of at least two P2Y-receptor subtypes can mobilize intracellular Ca2+ in trabecular cells. The moderately selective P2Y1 agonists ADP and 2-MeS-ATP exhibited response maxima that were 35 to 45% lower than values determined for ATP and UTP. The EC50 values measured for ADP and 2-MeS-ATP are consistent with the EC50 values for P2Y1 receptors measured in other mammalian tissues (Simon et al., 1995
; Nicholas et al., 1996
; Pacaud et al., 1996
; Ralevic and Burnstock, 1996
; Palmer et al., 1998
). In addition, the ADP- or 2-MeS-ATP-induced increase in intracellular Ca2+ was blocked by the pretreatment of P2Y1 antagonist MRS-2179. These data support the idea that both ADP- and 2-MeS-ATP stimulate the release of intracellular Ca2+ in trabecular cells through activation of the P2Y1 receptor. The expression of P2Y1 receptors in the HTM-3 cell line was confirmed by RT-PCR. The precise signal transduction pathways used by P2Y1 receptors in these cells are yet to be fully explored. Our results are consistent with other studies showing that P2Y1 receptors are coupled to an increase in intracellular Ca2+ through a Gq/11/IP3 signaling system.
The increase in intracellular Ca2+ after the addition of UTP provides evidence that bovine and human trabecular cells also express one or more of the conventional uracilsensitive P2Y receptors (i.e., P2Y2, P2Y4, or P2Y6). The lack of any measurable increase in intracellular Ca2+ after UDP administration, and the absence of any detectable mRNA in RT-PCR analysis, demonstrates that this response in not due to the activation of P2Y6 receptors in these cells. Because RT-PCR analysis also failed to detect P2Y2 receptors in the human HTM-3 cell line, and the calculated EC50 value for UTP is similar to that reported for P2Y4 receptors in other systems, the responses to UTP in these cells seems to result from P2Y4 receptor activation. However, recent studies have shown that UTP can mobilize intracellular Ca2+ by activating P2Y11 receptors (White et al., 2003
). Because RT-PCR analysis did detect P2Y11 receptor in HTM-3 cell line, we cannot exclude the possibility that UTP mobilizes intracellular Ca2+ via the activation of P2Y11 receptors.
Studies have shown that P2Y4 receptors derived from rat and human cells can be activated by both ATP and UTP (von Kugelgen and Wetter, 2000
). However, in P2Y4 receptors derived from human cells ATP potency is normally less than that measured for UTP (von Kugelgen and Wetter, 2000
). In this study, the calculated EC50, response maxima, and antagonist sensitivity for ATP were very similar to that determined for UTP, for both human- and bovine-derived cells. Cross-desensitization studies also demonstrated that ATP treatment did not alter subsequent responses to UTP. These studies provide evidence that ATP and UTP responses are mediated by separate receptors. Because ATP responses were not blocked by P2Y1 antagonist MRS-2179 the ATP-induced increase in intracellular Ca2+ seems to be mediated by P2Y11 receptors expressed in these cells. However, the final determination will require the development of selective P2Y receptor antagonists.
Activation of the ERK1/2 pathway in trabecular cells has been shown to regulate matrix metalloproteinase secretion and cellular proliferation (Shearer and Crosson, 2001
; Alexander and Acott, 2003
; Jeon et al., 2003
). In addition, the agents that alter IOP have been shown to regulate ERK1/2 activity in the trabecular meshwork (Shearer and Crosson, 2002
). Hence, the activation of the ERK1/2 signaling pathway seems to play a central role in the regulation of trabecular function (Shearer and Crosson, 2002
). The addition of ATP, UTP, ADP, or 2-MeS-ATP each activated ERK1/2 in HTM-3 and bovine trabecular cells. The ATP- and UTP-induced activation of ERK1/2 was blocked by pretreatment with the MEK inhibitor U-0126 or the PKC antagonist chelerythrine chloride. These results are consistent with the idea that activation of P2Y receptors leads to mobilization of intracellular Ca2+, activating calcium-sensitive PKC, and eventually activating ERK1/2 in these cells. Unlike the Ca2+ mobilization studies, no significant difference in response magnitude was measured in these experiments. The activation of ERK1/2 by UTP in these studies indicates that uracil-sensitive P2Y4 receptors are linked to ERK activation. Additionally, the inability of MRS-2179 to inhibit ERK activation induced by ADP or 2-MeS-ATP argues that the P2Y1 receptor is not linked to this pathway. However, we cannot exclude the possibility that ERK activation observed after the addition of nucleotides also results from the activation of P2Y11 receptors.
Original studies considered the trabecular meshwork a passive filter for aqueous humor, with changes in resistance to aqueous flow occurring indirectly through ciliary muscle contraction. Recent studies have demonstrated that trabecular cells are contractile in nature and are capable of modifying the extracellular matrix within the region, supporting the idea that these cells participate in the regulation of outflow resistance and IOP (Yue, 1996
; Wiederholt et al., 2000
; Shearer and Crosson, 2001
). Because the elevation in intracellular Ca2+ regulates trabecular cell contractility, and ERK has been shown to regulate matrix metalloproteinases, P2Y receptors may play an important role in regulation of trabecular function and aqueous outflow resistance. Recent studies have shown that P2 receptors modulate IOP (Pintor et al., 2003
). Therefore, we speculate that pharmacological agents targeting trabecular P2Y receptors may prove to be efficacious agents for the treatment of glaucoma.
In summary, these data demonstrate that multiple P2Y receptors are present in human and bovine trabecular meshwork cells. Our results are consistent with the idea that the activation of P2Y1, P2Y4, and P2Y11 receptors leads to the mobilization of intracellular Ca2+. The stimulation of the ERK1/2 signaling pathway seems to result from the activation of P2Y4 receptors via a PKC-dependent system. However, a role for the P2Y11 receptor in the activation of this pathway cannot be excluded.
| Acknowledgements |
|---|
| Footnotes |
|---|
Article, publication date, and citation information can be found at http://jpet.aspetjournals.org.
ABBREVIATIONS: IOP, intraocular pressure; ERK, extracellular signal-regulated kinase; DMEM, Dulbecco's modified Eagle's medium; 2-Mes-ATP, 2-methyl-thio-adenosine triphosphate; PPADS, pyridoxal phosphate-6-azophenyl-2',4'-disulfonic acid; 8-SPT, 8-sulfophenylthephylline; AM, acetoxymethyl ester; FBS, fetal bovine serum; PCR, polymerase chain reaction; MEK, mitogen-activated protein kinase kinase; PKC, protein kinase C; RT-PCR, reverse transcription-polymerase chain reaction; RT, reverse transcription; MRS-2179, 2'-deoxy-N6-methyladenosine-3',5'-diphosphate; U-0126, 1,4-diamino-2,3-dicyano-1,4-bis(o-aminophenylmercapto)butadiene.
Address correspondence to: Dr. Craig E. Crosson, Storm Eye Institute, 167 Ashley Ave., Charleston, SC 29425. E-mail: crossonc{at}musc.edu
| References |
|---|
|
|
|---|
Abbracchio MP, Boeynaems J-M, Barnard EA, Boyer JL, Kennedy C, Miras-Portugal MT, King BF, Gachet C, Jacobson KA, Weisman GA, et al. (2003) Characterization of the UDP-glucose receptor adds diversity to the P2Y receptor family. Trends Pharmacol Sci 24: 52-55.[CrossRef][Medline]
Abbracchio MP and Burnstock G (1994) Purinoceptors: are there families of P2X and P2Y purinoceptors? Pharmacol Ther 64: 445-475.[CrossRef][Medline]
Alexander JP and Acott TS (2003) Involvement of the Erk-MAP kinase pathway in TNTalpha regulation of trabecular matrix metalloproteinases and TIMPs. Investig Ophthalmol Vis Sci 44: 164-169.
Collison DJ and Duncan G (2001) Regional differences in functional receptor distribution and calcium mobilization in the intact human lens. Investig Ophthalmol Vis Sci 42: 2355-2363.
Communi D, Gonzales NS, Detheux M, Brezillon S, Lannoy V, Parmentier M, and Boeynaems J-M (2001) Identification of a novel human ADP receptor coupled to G1. J Biol Chem 276: 41479-41485.
Cowlen MS, Zhang VZ, Warnock L, Moyer CF, Peterson WM, and Yerxa BR (2003) Localization of ocular P2Y2 receptor gene expression by in situ hybridization. Exp Eye Res 77: 77-84.[CrossRef][Medline]
Cullinane AB, Coca-Prados M, and Harvey BJ (2001) Extracellular ATP effects on calcium signaling in cultured human non-pigmented ciliary body epithelium. Curr Eye Res 23: 448-454.[CrossRef][Medline]
Farahbakhsh NA and Cilluffo MC (2002) P2 purinergic receptor-coupled signaling in the rabbit ciliary body epithelium. Investig Ophthalmol Vis Sci 43: 2317-2325.
Greiner JV, Chanes LA, and Glonek T (1991) Comparison of phosphate metabolites of the ocular humors. Ophthalmic Res 23: 92-97.[Medline]
Jabs R, Guenther E, Marquordt K, and Wheeler-Schilling TH (2000) Evidence for P2X(3), P2X(4), P2X(5) but not for P2X(7) containing purinergic receptors in Muller cells of the rat retina. Brain Res Mol Brain Res 76: 205-210.[Medline]
Jeon JW, Lee SJ, Kim JB, Kang JJ, Lee JH, Seong GJ, and Kim EK (2003) Cellular proliferative effect of dexamethasone in immortalized trabecular meshwork cell (TM5) line. Yonsei Med J 44: 299-306.[Medline]
Merriman-Smith R, Tunstall M, Kistler J, Donaldson P, Housley G, and Eckert R (1998) Expression profiles of P2-receptor isoforms P2Y1 and P2Y2 in the rat lens. Investig Ophthalmol Vis Sci 39: 2791-2796.
Nicholas RA, Watt WC, Lazarowski ER, Li Q, and Harden K (1996) Uridine nucleotide selectivity of three phospholipase C-activating P2 receptors: identification of a UDP-selective, a UTP-selective and an ATP- and UTP-specific receptor. Mol Pharmacol 50: 224-229.[Abstract]
North RA (2002) Molecular physiology of P2X receptors. Physiol Rev 82: 1013-1067.
Pacaud P, Feolde E, Frelin C, and Loirand G (1996) Characterization of the P2Y-purinoceptor involved in the ATP-induced rise in cytosolic Ca2+ concentration in rat ileal myocytes. Br J Pharmacol 118: 2213-2219.[Medline]
Palmer RK, Boyer JL, Schachter JB, Nicholas RA, and Harden TK (1998) Agonist action of adenosine triphosphates at the human P2Y1 receptor. Mol Pharmacol 54: 1118-1123.
Pang IH, Shade DL, Clark AF, Steely HT, and DeSantis L (1994) Preliminary characterization of a transformed cell strain derived from human trabecular meshwork. Curr Eye Res 13: 51-63.[Medline]
Pintor J, Peral A, Pelaez T, Martin S, and Hoyle CH (2003) Presence of diadenosine polyphosphates in the aqueous humor: their effect on intraocular pressure. J Pharmacol Exp Ther 304: 342-348.
Ralevic V and Burnstock G (1996) Discrimination by PPADS between endothelial P2Y- and P2U-purinoceptors in the rat isolated mesenteric arterial bed. Br J Pharmacol 118: 428-434.[Medline]
Shearer T and Crosson CE (2001) Activation of extracellular signal-regulated kinase in trabecular meshwork cells. Exp Eye Res 73: 25-35.[CrossRef][Medline]
Shearer TW and Crosson CE (2002) Adenosine A1 receptor modulation of MMP-2 secretion by trabecular meshwork cells. Investig Ophthalmol Vis Sci 43: 3016-3020.
Simon J, Webb TE, and Barnard EA (1995) Characterization of a P2Y purinoceptor in the brain. Pharmacol Toxicol 76: 302-307.[Medline]
Tripathi BJ and Tripathi RC (1984) Effect of epinephrine in vitro on the morphology, phagocytosis and mitotic activity of human trabecular endothelium. Exp Eye Res 39: 731-744.[CrossRef][Medline]
von Kugelgen I and Wetter A (2000) Molecular pharmacology of P2Y-receptors. Naunyn-Schmiedeberg's Arch Pharmacol 362: 310-323.[CrossRef][Medline]
Wheeler-Schilling TH, Marquordt K, Kohler K, Guenther E, and Jabs R (2001) Identification of purinergic receptors in retinal ganglion cells. Brain Res Mol Brain Res 92: 177-180.[Medline]
Wheeler-Schilling TH, Marquordt K, Kohler K, Jabs R, and Guenther E (2000) Expression of purinergic receptors in bipolar cells of the rat retina. Brain Res Mol Brain Res 76: 415-418.[Medline]
White PJ, Webb TE, and Boarder MR (2003) Characterization of a Ca2+ response to both UTP and ATP at human P2Y11 receptors: evidence for agonist-specific signaling. Mol Pharmacol 63: 1356-1363.
Wiederholt M, Thieme H, and Stumpff F (2000) The regulation of trabecular meshwork and ciliary muscle contractility. Prog Retin Eye Res 19: 271-295.[CrossRef][Medline]
Yue BY (1996) The extracellular matrix and its modulation in the trabecular meshwork. Surv Ophthalmol 40: 379-390.[Medline]
Zhang FL, Luo L, Gustafson E, Palmer K, Qiao X, Fan X, Yang S, Laz TM, Bayne M, and Monsma F Jr (2002) P2Y13: identification and characterization of a novel Galphai-coupled ADP receptor from human and mouse. J Pharmacol Exp Ther 301: 705-713.
This article has been cited by other articles:
![]() |
D. Soto, J. Pintor, A. Peral, A. Gual, and X. Gasull Effects of Dinucleoside Polyphosphates on Trabecular Meshwork Cells and Aqueous Humor Outflow Facility J. Pharmacol. Exp. Ther., September 1, 2005; 314(3): 1042 - 1051. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||